CRISPR in Theory and Practise

I have always focused on basic research, motivated by a desire to understand the world-Jennifer Doudna

Prerequisites:

The practical part of the course is primarily intended for PhD students within the SLU Graduate School Organism Biology, but will be open to all interested PhD students and researchers who want to learn how to edit genomes of plants/fungi using the most recent and advanced CRISPR/Cas9 system. No previous experience in genome editing is required but experience in molecular biology is essential. All lectures will be carried out as open events, no registration is required to attend the theoretical part of the course.

Objectives:

After this course you should be able to design and implement CRISPR to manipulate your gene(s) of interest in, and validate the outcome of the procedure at the molecular level.

Content:

The course provides the participants with a strong theoretical background in genome editing in form of lectures, seminars and open discussion. Furthermore, different applications of genome editing will be covered. This course will provide hands-on training in genome editing and cell engineering in plant and fungal species using genome editing with special emphasis on CRISPR/Cas9. Participants will learn to design CRISPR strategies using bioinformatics, generate gene knockouts/knock-ins, and validate targets using the most state of the art technologies. During the practical part students will design and perform an experiment within a given framework, analyse the results and present the data in a form, which would be required for a publication. The course consists of roughly equal theoretical and practical parts and will run on part time over a 4 week period.

Examination:

Students are expected to attend theoretical parts, take active part in discussions and complete the practical part of the course. The practical part includes athe design of an experiment within a given framework, execution of the experiment and analysis of the data. The data should be presented as a written report in form of a materials and methods chapter plus a figure, prepared as it would be for a publication. At the end of the course, students will give a short presentation on how their research could benefit from the use of genome engineering.

Design gRNAs for this sequence to introduce an indel using online tools of your preference. You will need to be able to justify you selection.

Sequence (species Arabidopsis thaliana)

ATTGAAGAATCGTTAGATCCAGCGGAAGTTTTTTCTCCGACAAAGAACTCTTGAAGGTTGCAAGAATGGCAAAGAGAGCGTTGTTGATAGGAATCAACTATCCAGGAACCACGGAGGAGCTACAAGGCTGCGTCAATGACGTCCATAGAATGCATAAGTGTCTCGTTGACCGGTTCGGATTCGCGGAGGAAGATATCACTGTGCTGATTGACACCGACGAATCTTACACTCAACCCACAGGAAAGAACATCCGTCAGGCTTTGTCGGAGCTCATAAAGCCAGCAAAATCCGGTGACGTTTTATTCGTGCATTACAGCGGACACGGCACGAGAGTCCCACCGGAAACAGGGGAAGAGGATGATACAGGTTTTGATGAGTGTATTGTTCCTTCCGACTTGAATCCAATTCCTGGTAAGAGTTTATTATGGAATGGTTCCTTAGTTTAATGAAGAAAAACAGAGTGCTCTGTTTAAAACAGAGTGCTCTGTTTAGAATCTGTTTACCCCTCTCTTTGACTCTGTTAAGTCTCAAGGCTAGTTTTGAA

Design primers for inserting this sequence into the GOLDENGATE system in any level 0 module. You may also want to suggest your own system of modular cloning based on GOLDENGATE.
Discuss on what the next steps for the cloning procedure are and how you will evaluate your results.
Suggest a screening strategy for the validation that your gRNA has actually worked. How will you confirm that the above sequence contains a mutation?

Hints and tips for GOLDENGATE cloning method:

See the attached presentations and…